sense primer 5 aaaggtggtggatgggtgatg  (New England Biolabs)

Journal: Biochemistry and Biophysics Reports

Article Title: Mammalian fatty acid synthase and O -GlcNAc transferase preferentially interact via their respective N -terminal regions

doi: 10.1016/j.bbrep.2025.102427

Figure Lengend Snippet: FASN constructions used in this study. A. The delimitation of each domain is indicated by numbering the amino-acids. Each construction encodes a Flag-peptide located at the N-terminus. The domain boundaries shown are based on the UniProt primary sequence annotation (fatty acid synthase access number P49327 ). B. Domain boundaries shown are based on available experimental structures (PDB IDs: 3HHD , 8G7X , 4PIV , 4w82 and 7mhd ) ACP, Acyl Carrier Protein; DH, DeHydrogenase; ER, Enoyl-Reductase; KR, Keto-acyl Reductase; KS, Keto-acyl Synthase; MAT, Malonyl/Acetyl Transferase; TE, ThioEsterase.

Article Snippet: FASN gene was cloned into the pCMV10-3xFlag expression vector thanks to the Hin d III - FASN sense primer and FASN - Xba I antisense primer (Eurogentec) ( ).

Techniques: Sequencing

Journal: Biochemistry and Biophysics Reports

Article Title: Mammalian fatty acid synthase and O -GlcNAc transferase preferentially interact via their respective N -terminal regions

doi: 10.1016/j.bbrep.2025.102427

Figure Lengend Snippet: FASN and OGT interact via their respective N-terminal part. A and B. Hep3B cells were transfected with an empty vector (A) or with the different 3xFlag-FASN deletion mutants (B to G) in combination with OGT-HA overexpression. Protein samples were incubated with an anti-Flag antibody for co-immunoprecipitation with OGT (“IP” lanes for “Immuno-Precipitated”) ( panel A ) or with WGA-agarose beads (“P” lanes for “Purified”) ( panel B ). A. Co-immunoprecipitation of the deletion mutants with OGT analyzed by Western blotting. Optical densities of co-IP OGT were measured and normalized with the corresponding IP deletion mutants of FASN (red arrows; n = 3) (arbitrary units). B. O -GlcNAcylation levels of the deletion mutants analyzed by Western blotting. Specificity of WGA was checked by adding 0.5 M GlcNAc (“P + Gn” lane). Optical densities of the “purified” O -GlcNAcylated constructs were measured and normalized with inputs (red arrows; n = 3) (arbitrary units). ∗ p < 0.05; ∗∗ p < 0.01. C. Hep3B cells were transfected with 3xFlag-FASN. Protein samples were incubated with a GST-OGT construct (1–3) or GST only (4). After GST pull-down, interaction of the GST-OGT constructs (red arrows) with 3xFlag-FASN was analyzed by Western blotting. Optical densities of pull-down 3xFlag-FASN were measured and normalized with the corresponding construct. Interaction with GST only was subtracted from the other bands (n = 4). CD, Catalytic Domain; GST, Gluthatione-S Transferase; NLS, Nuclear Localization Signal; TPR, TetratricoPeptide Repeats. Dotted lines indicate where the blots were cut and joined during figure preparation. Molecular mass markers are indicated on the left (kDa).

Article Snippet: FASN gene was cloned into the pCMV10-3xFlag expression vector thanks to the Hin d III - FASN sense primer and FASN - Xba I antisense primer (Eurogentec) ( ).

Techniques: Transfection, Plasmid Preparation, Over Expression, Incubation, Immunoprecipitation, Purification, Western Blot, Co-Immunoprecipitation Assay, Construct

Journal: Biochemistry and Biophysics Reports

Article Title: Mammalian fatty acid synthase and O -GlcNAc transferase preferentially interact via their respective N -terminal regions

doi: 10.1016/j.bbrep.2025.102427

Figure Lengend Snippet: FASN and OGT interaction modeling. A. Modeling of FASN dimer and two OGT monomers; full sequences of the FASN dimer and of the OGT monomer were modeled independently with AlphaFold (see Materials and methods), assembled according to co-prediction performed in 3C and rendered in cartoon representation, FASN dimer in magenta and green (2511 residues each) and OGT monomers in cyan (1046 residues each). B. Same as A, but with FASN colored according to the domains depicted in and the four O -GlcNAcylated sites previously identified and reported, T315, S806, T980 and S1534, highlighted by red spheres . C. Model of FASN N -ter (bottom domain) and OGT N -ter (top domain, the TPR helices are clearly visible); the FASN sequence was trimmed to 1–969 and the OGT sequence to 1–286; the structure was predicted using AlphaFold3 and rendered in cartoon representation; residues are colored according to the pLDDT confidence score. D . Predicted Aligned Error matrix of the complex in C , ordered as OGT first and then FASN.

Article Snippet: FASN gene was cloned into the pCMV10-3xFlag expression vector thanks to the Hin d III - FASN sense primer and FASN - Xba I antisense primer (Eurogentec) ( ).

Techniques: Sequencing